《【病毒外文文獻(xiàn)】2009 SARS-coronavirus modulation of myocardial ACE2 expression and inflammation in patients with SARS》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2009 SARS-coronavirus modulation of myocardial ACE2 expression and inflammation in patients with SARS（8頁珍藏版）》請在裝配圖網(wǎng)上搜索。

SARS coronavirusmodulationofmyocardialACE2 expressionandinflammationinpatientswithSARS G Y Oudit 1 Z Kassiri C Jiang P P Liu S M Poutanen J M Penninger and J Butany University of Alberta Edmonton Canada Peking Union Medical College Beijing China University Health Network University of Toronto Toronto Canada Mount Sinai Hospital Toronto Canada Institute for Molecular Biotechnology of the Austrian Academy of Sciences Vienna Austria ABSTRACT Background Angiotensin converting enzyme 2 ACE2 a monocarboxylase that degrades angiotensin II to angiotensin 1 7 is also the functional receptor for severe acute respiratory syndrome SARS coronavirus SARS CoV and is highly expressed in the lungs and heart Patients with SARS also suffered from cardiac disease including arrhythmias sudden cardiac death and systolic and diastolic dysfunction Materials and methods We studied mice infected with the human strain of the SARS CoV and encephalomyo carditis virus and examined ACE2 mRNA and protein expression Autopsy heart samples from patients who succumbed to the SARS crisis in Toronto Canada were used to investigate the impact of SARS on myocardial structure inflammation and ACE2 protein expression Results Pulmonary infection with the human SARS CoV in mice led to an ACE2 dependent myocardial infection with a marked decrease in ACE2 expression confirming a critical role of ACE2 in mediating SARS CoV infection in the heart The SARS CoV viral RNA was detected in 35 7 20 of autopsied human heart samples obtained from patients who succumbed to the SARS crisis during the Toronto SARS outbreak Macrophage specific staining showed a marked increase in macrophage infiltration with evidence of myocardial damage in patients who had SARS CoV in their hearts The presence of SARS CoV in the heart was also associated with marked reductions in ACE2 protein expression Conclusions Our data show that SARS CoV can mediate myocardial inflammation and damage associated with down regulation of myocardial ACE2 system which may be responsible for the myocardial dysfunction and adverse cardiac outcomes in patients with SARS Keywords Angiotensin converting enzyme 2 heart macrophage SARS coronar virus severe acute respiratory syndrome Eur J Clin Invest 2009 39 7 618 625 Introduction Human and rodent angiotensin converting enzyme 2 ACE2 is an endothelium bound carboxymonopeptidase with single active site catalytic region whose expression is limited mainly to endothelial cells of the arteries arterioles and venules in various organs including the heart lungs and kidneys 1 2 Loss of ACE2 leads to an age dependent cardiomyopathy 1 3 and kid ney disease 4 while also enhancing pulmonary 5 cardiac 6 and renal injuries 7 In addition to its peptidase action ACE2 also functions as the receptor for the severe acute respiratory syndrome coronavirus SARS CoV 8 10 and ACE2 expres sion is necessary for the pulmonary infection by SARS CoV 10 12 Severe acute respiratory syndrome SARS spread rapidly through the world leading to significant morbidity and acute often lethal lung failure with a mortality of approximately 10 despite modern day therapies 11 12 In Toronto the SARS outbreak was associated with loss of lives considerable burden on the healthcare system and a huge economic impact 13 15 Fatal SARS is associated with a viraemic response suggesting that SARS CoV may affect other organs 16 Interestingly patients infected with the SARS CoV suffered from cardiac disease including systolic and diastolic dysfunction 17 1 Clinician Investigator of the Alberta Heritage Foundation for Medical Research 618 European Journal of Clinical Investigation Vol 39 DOI 10 1111 j 1365 2362 2009 02153 x SHORT REPORT arrhythmias and sudden death 18 We hypothesized that the interaction between SARS CoV and ACE2 in the heart could contribute to SARS mediated myocardial inflammation and damage We showed that pulmonary infection with the SARS CoV in mice leads to myocardial SARS CoV in an ACE2 depen dent manner coupled with down regulation of the myocardial Ace2 mRNA and loss of ACE2 protein In patients who died from SARS presence of SARS CoV in the heart was associated with greater macrophage infiltration and myocardial damage in association with decreased myocardial ACE2 protein expres sion Our results demonstrate that ACE2 plays a key role in mediating SARS CoV infection in the heart which in combina tion with down regulation of the myocardial ACE2 could be the underlying pathophysiological mechanism of SARS associ ated heart disease Materialsandmethods Experimental animals in vivo SARS CoV infection and EMC myocarditis protocol Mutant mice have been previously described 1 and only male littermate ACE2 mutant Ace2 y wild type Ace2 y con trols were used in this study All experiments were performed in accordance to institutional guidelines The SARS CoV Beijing strain PUMC01 isolate was used to infect mice via the intranasal route 10 and at day 2 mice were killed and the hearts were removed for further analyses Wild type C57BL 6 mice age 8 10 weeks were maintained in a sterile pathogen free environment and were injected peritoneally with 10 pla que forming units of encephalomyocarditis EMC virus or with normal saline as previously described 19 Mice were killed at 3 days postinfection and hearts were aseptically removed and frozen in liquid nitrogen All animal experiments were performed in accordance with the Institutional Guidelines and the Canadian Council on Animal Care Autopsies In the greater Toronto area Ontario Canada 44 patients died from SARS and 21 patients underwent autopsies Dr J Butany a staff cardiovascular pathologist at the University Health Network was the official pathologist of the SARS victims The control group consisted of autopsies from age and gender matched patients who were intubated and ventilated and died from pneumonia and sepsis over the same time period Our study was carried out in accordance with institutional research ethics board review Histology and immunohistochemistry Trichrome and haematoxylin eosin staining and visualization were carried out as previously described to assess for architec tural alterations inflammation and fibrosis 3 20 Macrophage and T lymphocyte specific staining using anti CD68 and anti CD3 antibodies respectively were carried out as previously described 20 21 Paraffin embedded sections were pretreated using the pepsin digestion method followed by treatment with mouse monoclonal anti CD68 antibody Dako Labs clone PGM1 1 100 dilution Mississauga ON Canada or rabbit polyclonal anti CD3 antibody Dako Labs 1 100 dilution Sections were then incubated with biotinylated multilink secondary antibody ID Labs Biotechnology Inc London ON Canada and treated with horse peroxidase conjugated strepavidin labelling reagent ID Labs Biotechnology Inc Macrophage counts degree of inflammation fibrosis and cardiomyocyte cross sectional area were obtained from three sections from each heart with five ran dom views from each section as previously described 3 Apop tosis was assessed by the terminal deoxynucleotidyl transferase mediated dNTP end labelling TUNEL using the ApopTag Plus kit Intergen Purchase New York NY USA 20 Immunohisto chemistry for ACE2 was carried out using anti ACE2 antibody as previously described 10 and quantified as previously described 3 Real time PCR and Western blot analysis Ethics approval and real time PCR analysis of human heart samples for the SARS CoV was performed as previously described 22 23 Reverse transcriptase polymerase chain reac tion RT PCR analysis was in agreement with the diagnostic criteria for SARS as established by various agencies including the World Health Organization WHO and Centre for Disease Control CDC The homogenized heart samples were purified using Q1A shredder columns prior to RNA isolation by using the RNeasy Mini Kit Qiagen Inc Mississauga ON Canada The RT PCR was carried out by using the Real Art HPA Coro navirus virus LightCycler RT Reagents Assay Artus GmbH Hamburg Germany with 80 LightCycler real time platform Roche Diagnostics Laval Canada The 80 bp region of the SARS CoV RNA polymerase gene was amplified using previ ously published methods 22 Western blot analysis for myo cardial ACE2 protein was carried out using a primary mouse ACE2 specific polyclonal antibody generated in our laboratory at a 1 1000 dilution and a secondary goat antimouse antibody 1 5000 BD Biosciences Mississauga ON Canada as previ ously described 1 7 Analysis of myocardial Ace2 mRNA expression was carried out using Taqman real time PCR using the forward primer 5 GGATACCTACCCTTCCTACAT CAGC 3 reverse primer 5 CTACCCCACATATCACCAAG CA 3 and probe 5 FAM CCACTGGATGCCTCCCTGCCC TAMRA 3 as previously described 7 10 Statistical analysis All data are shown as mean SEM All statistical analyses were performed using SPSS software Chicago IL USA Version European Journal of Clinical Investigation Vol 39 619 ACE2 HEART DISEASE AND SEVERE ACUTE RESPIRATORY SYNDROME 10 1 We used ANOVA followed by the Student s Neuman Keuls test for multiple comparison testing while the Student s t test was used for comparisons between any two groups Results ACE2 mediates myocardial SARS CoV infection and leads to its down regulation Angiotensin converting enzyme 2 is the functional receptor for the SARS CoV and mediates SARS CoV pulmonary infection 8 10 We examined the myocardial response to pulmonary infection with the SARS CoV Within 2 days following SARS CoV infection there was a marked presence of the SARS CoV in the heart of wild type Ace2 y mice while SARS CoV levels were reduced in the hearts of Ace2 y mice providing the first evidence for dependence of myocardial SARS CoV infection on ACE2 expression Fig 1a Interestingly this process lead to a partial down regulation of Ace2 mRNA expression in wild type mice Fig 1b in association with a complete loss of myocardial ACE2 protein levels Fig 1c d These results show that in a well validated pulmonary murine model of SARS 10 SARS CoV can clearly infect the heart and modulate ACE2 expression To decipher whether the effects on ACE2 expression is mediated directly by SARS CoV vs a secondary myocarditis process we studied the encephalomyocarditis EMC virus induced murine model of viral myocarditis Consistent with the impact of SARS CoV on myocardial Ace2 mRNA expression EMC viral myocar ditis was associated with a significant decrease in Ace2 mRNA Fig 1e In contrast myocardial ACE2 protein levels showed a significant increase Fig 1f g suggesting an increased transcrip tional efficiency of Ace2 mRNA and or reduced proteolytic processing of ACE2 These results demonstrate that pulmonary infection with SARS CoV in our murine model leads to myocar dial SARS CoV in an ACE2 dependent manner in association Figure 1 Pulmonary SARS CoV infection leads to myocardial SARS CoV infection and down regulation of myocardial ACE2 expres sion a d Human SARS CoV mRNA in the hearts of infected mice showing a clear dependence on ACE2 for myocardial SARS CoV infection a with down regulation of myocardial Ace2 mRNA expression based on real time PCR b and myocardial ACE2 protein levels shown by Western blot analysis c and quantification d in response to pulmonary SARS CoV infection P 0 01 compared with infected Ace2 y group P 0 01 compared with uninfected group n 5 ND not detectable e g Discordant changes in myocardial Ace2 mRNA and myocardial ACE2 protein levels in encephalomyocarditis EMC virus induced myocarditis with real time PCR showing reduced myocardial Ace2 mRNA e with increased myocardial ACE2 protein levels based on Western blot analysis f and quantification g P 0 01 compared with placebo group n 5 620 2009 The Authors Journal Compilation 2009 Stichting European Society for Clinical Investigation Journal Foundation G Y OUDIT ET AL www ejci with decreased myocardial Ace2 mRNA expression and a specific reduction in myocardial ACE2 protein levels Presence of SARS CoV in autopsied heart samples in association with myocardial damage Interestingly severe cardiac dysfunction has also been described in patients with SARS 17 18 Given the high expres sion of ACE2 in the heart 1 24 coupled with the observation that SARS CoV is detectable in the plasma of SARS patients 12 25 we examined whether pulmonary SARS CoV infection leads to myocardial SARS CoV infection in patients who died from SARS We examined the archived postmortem autopsy heart tissues from patients who had succumbed to the SARS crisis for the evidence of myocardial SARS CoV infection Twenty patients all of whom had confirmed diagnoses of SARS with SARS CoV being detected in their lungs were studied Reverse transcriptase polymerase chain reaction analysis showed that 35 of the patients 7 of 20 had positive SARS CoV genome detected in the heart Fig 2a with an average viral load of 4 07 10 6 copies of SARS CoV per gram of heart tissue age 70 12 years 3M 4F Importantly the duration of the illness was significantly shortened in patients with detect able SARSCoV in their hearts n 7 3 9 2 3 days vs patients without SARS CoV in the heart n 13 43 2 9 7 days P 0 05 Fig 2a These results indicate that in patients with SARS pulmonary SARS CoV infection can clearly lead to Figure 2 Detection of SARS CoV genome in postmortem human heart samples with evidence of myocardial inflammation and damage a Presence of SARS CoV genome in the heart of 35 of the patients who died from SARS SARS CoV open bar n 7 and its negative impact on illness duration compared with patients who died from SARS without SARS CoV in the heart SARS CoV closed bar n 13 P 0 05 compared with SARS CoV group b h Representative trichrome stained myocardial section obtained from a patient who died from non SARS related sepsis bacterial pneumonia b SARS with evidence of SARS CoV in the heart c SARS without evidence of SARS CoV in the heart d showing increased interstitial fibrosis and inflammation e and cardiomyocyte hypertrophy based on myocyte cross sectional area MCSA f without evidence of apoptosis in patients who died from SARS with g and without h evidence of SARS CoV in the heart Scale bar represents 50 lM P 0 01 compared with all other groups VL ve and VH ve patients who died from a non SARS related sepsis open bar VL ve and VH ve patients who died from SARS with SARS CoV in the heart grey bar and VL ve and VH ve patients who died from SARS without SARS CoV in the heart closed bar n 7 per group European Journal of Clinical Investigation Vol 39 621 ACE2 HEART DISEASE AND SEVERE ACUTE RESPIRATORY SYNDROME SARS CoV infection in the heart resulting in a more aggressive illness and earlier death Trichrome staining showed increased myocardial inflammation and interstitial fibrosis in patients who had SARS CoV detected in their hearts Fig 2a e The presence of myocardial inflammation and reduced ACE2 expression in response to myocardial SARS CoV infection was associated with pathological hypertrophy as shown by increased cardiomyocyte cross sectional area Fig 2f Assess ment of apoptosis using TUNEL staining revealed no increased apoptosis in the autopsied heart samples Fig 2g h Myocardial macrophage infiltration in patients with myocardial SARS CoV The presence of SARS CoV in the heart suggests that this could lead to myocardial inflammation We used a positive control group that consisted of 13 patients who died from SARS with out evidence of SARS CoV in the heart age 67 12 years 6M 7F and negative control group consisting of patients who died from bacterial pneumonia and did not have SARS n 7 age 68 9 years 3M 4F Immunohistochemical staining of postmortem myocardial tissue using a macrophage specific CD 68 cell surface marker revealed a significant amount of macrophage infiltration Fig 3a d which was clearly increased in patients who had SARS CoV in their hearts with only a minor elevation in patients without SARS CoV in the heart Fig 3e In contrast immunohistochemical staining of T cell specific CD 3 cell surface marker showed that myocar dial lymphocytic infiltration was minimal Fig 3f h with no significant difference in lymphocyte count between groups Fig 3i Figure 3 Increased macrophage infiltration in the absence of increased lymphocytic infiltration in the left ventricle of patients who died from SARS a e Representative anti CD68 stained immunohistochemistry section from a patient who died from non SARS related sepsis bacterial pneumonia a SARS with evidence of SARS CoV in the heart b SARS without evidence of SARS CoV in the heart c and a positive control section obtained from human spleen d with quantification of myocardial macrophage count e f i Representative anti CD3 immunohistochemistry illustrating a representative section from a patient who died from SARS with evidence of SARS CoV in the heart f SARS without evidence of SARS CoV in the heart g and a positive control section obtained from human spleen h with quantification of myocardial lymphocyte count i Scale bar represents 50 lM P 0 05 compared with all other groups VL ve and VH ve patients who died from a non SARS related sepsis open bar VL ve and VH ve patients who died from SARS with SARS CoV in the heart grey bar and VL ve and VH ve patients who died from SARS without SARS CoV in the heart closed bar n 7 per group 622 2009 The Authors Journal Compilation 2009 Stichting European Society for Clinical Investigation Journal Foundation G Y OUDIT ET AL www ejci Reduced ACE2 protein expression in patients with myocardial SARS CoV The ability of SARS CoV to utilize ACE2 as a receptor in vivo and the presence of SARS CoV in the heart suggests that SARS CoV can interact with the myocardial ACE2 system We hypothesized that the presence of SAR CoV in the hearts could be associated with decreased ACE2 protein expression Consis tent with our observations in our murine model immunohisto chemistry for myocardial ACE2 protein expression showed that the presence SARS CoV in the heart was associated with marked down regulation of ACE2 protein expression Fig 4a c which was quantified and shown in Fig 4f The specificity of our anti ACE2 antibody was shown by pre incubation with human recombinant ACE2 1 mg mL 1 kindly provided by Apeiron Biologics Austria which blocked most of the immunostaining for the native ACE2 protein Fig 4e Discussion Patients who were infected with the SARS virus suffered from cardiac disease ranging from systolic and diastolic dysfunction 17 arrhythmias and sudden death 18 In this study we have provided evidence that ACE2 functions as the myocardial SARS CoV receptorinvivo Respiratory SARS CoV infection in our murine model leads to an ACE2 dependent SARS CoV infec tion in the heart and decreased myocardialAce2mRNA expres sion Cytokine mediated transcriptional down regulation of Ace2mRNA could have lead to decreasedAce2mRNA level in SARS CoV and EMC mediated viral myocarditis 26 Virus mediated receptor down modulation has been described for multiple viruses including HIV measles and pulmonary SARS CoV 10 The complete loss of ACE2 protein in hearts infected with SARS CoV could be secondary to the activation of ADAM 17 TACE by the SARS spike protein which is known to cleave and release ACE2 27 and or due to SARS CoV binding to ACE2 in the endothelial cells leading to endocytosis of the ligand receptor complex 12 28 and subsequent intracellular degradation of ACE2 In patients who succumbed to SARS SARS CoV was detected in the heart of 35 of the subjects suggesting that SARS CoV is capable of infecting the myocardium in suscepti ble individuals We showed that patients who had SARS CoV in their hearts died considerably earlier suggesting that myo cardial SARS CoV infection was associated with a more aggres sive course of illness SARS CoV interaction with ACE2 led to SARS associated cardiomyopathy and likely contributed signif Figure 4 Reduced ACE2 protein expression in patients who died from SARS and had SARS CoV detected in their hearts a e Rep resentative sections show