《【病毒外文文獻(xiàn)】2009 Coronavirus Genetically Redirected to the Epidermal Growth Factor Receptor Exhibits Effective Antitumor Activity ag》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2009 Coronavirus Genetically Redirected to the Epidermal Growth Factor Receptor Exhibits Effective Antitumor Activity ag（10頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

JOURNAL OF VIROLOGY Aug 2009 p 7507 7516 Vol 83 No 15 0022 538X 09 08 00H110010 doi 10 1128 JVI 00495 09 Copyright 2009 American Society for Microbiology All Rights Reserved Coronavirus Genetically Redirected to the Epidermal Growth Factor Receptor Exhibits Effective Antitumor Activity against a Malignant Glioblastoma H17188 Monique H Verheije 1 Martine L M Lamfers 2 Thomas Wu rdinger 1 Guy C M Grinwis 3 Winald R Gerritsen 4 Victor W van Beusechem 4 and Peter J M Rottier 1 Virology Division Department of Infectious Diseases and Immunology Utrecht University Utrecht The Netherlands 1 Department of Neurosurgery Erasmus University Rotterdam The Netherlands 2 Pathology Division Department of Pathobiology Utrecht University Utrecht The Netherlands 3 and Department of Medical Oncology VU University Medical Center Amsterdam The Netherlands 4 Received 10 March 2009 Accepted 6 May 2009 Coronaviruses are positive strand RNA viruses with features attractive for oncolytic therapy To investigate this potential we redirected the coronavirus murine hepatitis virus MHV which is normally unable to infect human cells to human tumor cells by using a soluble receptor soR based expression construct fused to an epidermal growth factor EGF receptor targeting moiety Addition of this adapter protein to MHV allowed infection of otherwise nonsusceptible EGF receptor EGFR expressing cell cultures We introduced the sequence encoding the adaptor protein soR EGF into the MHV genome to generate a self targeted virus capable of multiround infection The resulting recombinant MHV was viable and had indeed acquired the ability to infect all glioblastoma cell lines tested in vitro Infection of malignant human glioblastoma U87H9004EGFR cells gave rise to release of progeny virus and efficient cell killing in vitro To investigate the oncolytic capacity of the virus in vivo we used an orthotopic U87H9004EGFR xenograft mouse model Treatment of mice bearing a lethal intracranial U87H9004EGFR tumor by injection with MHVsoR EGF significantly pro longed survival compared to phosphate buffered saline treated P H11549 0 001 and control virus treated P H11549 0 004 animals and no recurrent tumor load was observed However some adverse effects were seen in normal mouse brain tissues that were likely caused by the natural murine tropism of MHV This is the first demon stration of oncolytic activity of a coronavirus in vivo It suggests that nonhuman coronaviruses may be attractive new therapeutic agents against human tumors Already for quite some years oncolytic viruses are being investigated for use in human tumor therapy for recent re views see references 3 16 22 37 and 44 Their success in destroying human cancer cells depends on their ability to se lectively infect and kill these cells Although some oncolytic viruses appear to have a natural tropism for tumor cells most viruses need to be modified in some way to achieve infection and or lytic activity in these cells One of the ways to accom plish specific infection of tumor cells is by redirecting the virus to epitopes expressed on such cells Thus different targeting approaches have been explored for a variety of viruses These include pseudotyping modification of viral surface proteins and the use of bispecific adapters 14 35 45 All of these approaches require that the viability of the virus is not ham pered and that the targeting moiety is properly exposed to allow directed infection The ability to genetically modify a particular virus combined with the availability of an appropri ate targeting epitope determines the success of the approaches Coronaviruses are enveloped positive strand RNA viruses belonging to the order Nidovirales The nonhuman coronavirus murine hepatitis virus MHV is the best studied coronavirus and more importantly convenient reverse genetics systems are available to modify its genome 19 50 MHV has several appealing characteristics that might make it suitable as an oncolytic virus First it has a narrow host range determined by the interaction of its spike S glycoprotein with the cellular receptor mCEACAM1a Since mCEACAM1a is not expressed on human cells MHV cannot establish an infection in either normal or cancerous human cells Second infection by MHV induces the formation of large multinucleated syncytia to which also surrounding uninfected cells are recruited 42 Hence given also its relatively short replication cycle 6 to 9 h MHV destroys populations of cells rapidly once they have become infected Third the tropism of MHV can be modified either by substitution of the viral spike ectodomain 19 or by the use of adapter proteins 43 47 48 These adapter pro teins composed of a virus binding moiety coupled to a target cell binding device can redirect the virus to a specific receptor on the target cell 43 47 48 The studies revealed that once the host cell tropism barrier is alleviated MHV is capable of establishing infection in nonmurine cells The use of adapter proteins to target therapeutic viruses to tumor cells modeled in Fig 1A is limited by the necessity to externally provide and replenish the adapter protein To over come this obstacle the genetic information for the targeting device can be introduced into the viral genome to allow the virus to produce the adaptor itself in infected cells thereby Corresponding author Mailing address Virology Division De partment of Infectious Diseases and Immunology Utrecht University Yalelaan 1 3584 CL Utrecht The Netherlands Phone 31 30 253 2462 Fax 31 30 253 6723 E mail p rottier uu nl Present address Departments of Neurology and Radiology Har vard Medical School Boston Massachusetts and Neuro oncology Re search Group Department of Neurosurgery VU Medical Center Cancer Center Amsterdam Amsterdam The Netherlands H17188 Published ahead of print on 13 May 2009 7507 on May 5 2015 by ST ANDREWS UNIV http jvi asm org Downloaded from creating a self targeted virus Indeed we demonstrated the feasibility of this concept by expressing an adapter protein composed of the relevant soluble domain of the mCEACAM1a receptor linked to a His tag as an additional protein from the MHV genome 43 We extend these inves tigations here by coupling the epidermal growth factor EGF protein to the mCEACAM1a fragment Introduction of this expression cassette encoding the adapter protein allowed mul tiround infection in EGF receptor EGFR expressing human cells resulting in extensive cell cell fusion and efficient killing of target human glioblastoma cells Using an orthotopic intra cranial tumor model of aggressive U87H9004EGFR glioblastomas in nude mice we show for the first time that redirected coro navirus has oncolytic potential MATERIALS AND METHODS Cells and viruses Murine LR7 cells 19 feline FCWF 4 cells 34 murine Ost 7 cells 13 hamster CHO CHO His scFv 18 and CHO EGFR cells the latter two kindly provided by T Nakamura Rochester MN 29 and human glioblastoma U373MG U251MG Gli6MG U87MG and U87H9004EGFR cells the generation of U87H9004EGFR is described in reference 31 were all maintained in Dulbecco modified Eagle medium Cambrex BioScience Verviers Belgium containing 10 fetal calf serum 100 IU of penicillin ml and 100 H9262g of strepto mycin ml all from Life Technologies Ltd Paisley United Kingdom Stocks of MHV EFLM 8 MHVd2aHE 7 recombinant felinized fMHV 19 and MHVsoR h His 43 were grown and titrated as described previously 43 Construction of the genes encoding the adapter proteins soR h His and soR EGF and production of the adapter proteins The construction of soR h His has been described elsewhere 43 The gene encoding the amino terminal D1 do main of the mCEACAM1a receptor soR fused to EGF was generated similarly Briefly to generate the EGF gene two annealing primers were used as a tem plate in a PCR CATTGCGGCCGCCAATAGTGACTCTGAATGTCCCCTG TCCCACGATGGGTACTGCCTCCATGATGGTGTGTGCATGTATATTG AAGCTCTAGACAAGTAT sense nucleotides nt 1 to 90 and ACTTGGGC CCGCGCAGTTCCCACCACTTCAGGTCTCGGTACTGACATCGCTCCCC GATGTAGCCAACAACACAGTTGCATGCATACTTGTCTAGAGCTTC antisense nt 70 to 160 using a forward primer TGCAGCGGCCGCCAATAG TGACTCTGAATGT sense nt 1 to 18 and a reverse primer CTAGGCGGC CGCGCGCAGTTCCCACCACTT antisense nt 141 to 159 The resulting DNA fragment contained a 5H11032 and 3H11032 NotI site underlined in the primers and was subsequently cloned using this restriction enzyme into pSTsoR His 43 a derivative of the expression vector pSecTag2 Invitrogen Breda The Nether lands resulting in pSTsoR EGF The sequence of the gene encoding the adapter protein was confirmed by sequencing Recombinant vaccinia virus vTF7 3 expressing the bacteriophage T7 RNA polymerase gene was used as a T7 RNA polymerase source for T7 promoter driven production of the soR adapter proteins in OST7 1 cells 10 as described previously 43 Luciferase expression assay Monolayers of 0 32 cm 2 of CHO CHO His scFv and CHO EGFR cells were inoculated with 10 4 tissue culture infective doses TCID 50 as determined by endpoint dilution on LR7 cells of the firefly lucif erase expressing MHV EFLM 8 preincubated at 4 C for 1 h with the indicated amounts of adapter proteins At the indicated time points the cells were lysed and intracellular luciferase expression was measured as described previously 43 Targeted RNA recombination The construction of MHVsoR h His by tar geted RNA recombination has been described before 43 MHVsoR EGF was generated in a similar way first a transcription regulation sequence TRS was introduced into pSTsoR EGF directly upstream of the soR encoding region to allow expression of the adapter proteins from an additional expression cassette in the MHV A59 genome Next the fragment TRS soR EGF was cloned in two successive steps into pMH54 19 resulting in transcription vector pMHsoR EGF suitable for targeted recombination Targeted RNA recombination was performed as described previously 7 19 Briefly donor RNA transcribed in vitro from the PacI linearized plasmid pMHsoR EGF was transfected by elec troporation into feline FCWF 4 cells that had been inoculated at a multiplicity of infection MOI of 0 5 with fMHV 4 h earlier These cells were then plated in culture flasks and the culture supernatant was harvested 24 h later Progeny virus was plaque purified and virus stocks were grown in LR7 cells After confirmation of the presence of the additional expression cassette by reverse transcription PCR on purified viral RNA from these virus stocks the titers of the stocks were determined by endpoint dilution on LR7 cells These passage 2 virus stocks were subsequently used in the experiments Analysis of viral growth kinetics An amount of 10 5 cells per 2 cm 2 well of the indicated cells was inoculated with 0 5 H11003 10 5 TCID 50 After 1 h the culture supernatant was removed the cells were washed and fresh culture medium was added At several time points postinfection p i an 20 H9262l aliquot of the medium was harvested and stored at H1100280 C until analysis The amount of virus produced at each time point was determined by endpoint dilution on LR7 cells and the TCID 50 values were calculated FIG 1 Redirection of MHV to the EGFR A Rationale for using adapter proteins to target viruses to a specific receptor present on target cells Adapters either added or expressed from the viral genome when incorporated enable targeted infection of otherwise nonsuscep tible cells B Schematic diagram of the expression constructs pSTsoR h His and pSTsoR EGF The IgH9260 signal sequence directs adapter pro tein secretion the N terminal D1 domain of mCEACAM1a soR provides for binding to and induction of conformational changes in the MHV spike protein and the six amino acid His tag His provides for binding to the artificial His receptor The hinge h linker region present in soR h His allows formation of disulfide linked dimers of the resulting adapter protein 43 T7 T7 promoter myc myc tag ala3 alanine tripeptide C Targeting of MHV EFLM to the His receptor and to the EGFR on CHO cells using soR h His and soR EGF re spectively CHO CHO His scFv and CHO EGFR cells were inocu lated with MHV EFLM preincubated with soR h His or soR EGF and the luciferase activities expressed as relative light units RLU were measured The values depicted are the means of an experiment performed in triplicate Error indicators show the standard deviations 7508 VERHEIJE ET AL J VIROL on May 5 2015 by ST ANDREWS UNIV http jvi asm org Downloaded from Antibody blocking experiments To determine whether MHVsoR EGF infec tion of CHO EGFR cells is specifically mediated by the EGFR cells were preincubated with different amounts of hybridoma supernatant containing monoclonal antibody MAb 425 directed against the EGFR for 30 min at 4 C Next the cells were inoculated with 10 4 TCID 50 of MHVsoR EGF for1hat 37 C The cells were washed and incubated for 20 h after which they were fixed and stained to analyze the expression of viral proteins Immunoperoxidase staining of cell cultures Cells inoculated with MHVsoR h His or MHVsoR EGF were fixed with phosphate buffered saline PBS con taining 3 7 paraformaldehyde Immunostainings were performed as described before 43 using K135 anti MHV serum 36 Monolayer cytotoxicity analysis A total of 5 H11003 10 4 U87H9004EGFR cells per 0 32 cm 2 well was seeded and infected the next day in triplicate with MHVsoR EGF at an MOI of 5 At several time points after inoculation the culture medium was replaced by Dulbecco modified Eagle medium containing 10 WST 1 Roche Diagnostics GmbH Mannheim Germany and the cells were cultured for 30 min Hereafter the optical density at 450 nm was measured and the viability of the infected cells was determined as described previously 43 Animal experiments For assessing the therapeutic effect of MHVsoR EGF in vivo an intracranial glioblastoma xenograft mouse model was applied as de scribed previously 20 Eight week old female SPF athymic nu nu mice Harlan Horst The Netherlands were stereotactically injected with 10 5 U87H9004EGFR cells in 3 H9262l of PBS into the right frontal lobe 2 5 mm lateral to the bregma at a depth of 2 5 mm Injections were done under anesthesia induced by intraperi toneal injection of 2 mg of ketamine and 0 4 mg of xylazine in 0 9 saline After 4 days 10 5 MHVsoR EGF 10 5 MHVsoR h His or PBS all in a total volume of 3 H9262l was inoculated stereotactically into the same coordinates Animals were monitored daily and sacrificed upon manifestation of clinical symptoms such as paralysis and lethargy indicative of a moribund state From each experimental group one animal was sacrificed at day 9 after tumor cell inoculation while the others were monitored long term to be able to score for survival MHVsoR h His and PBS treated each group composed of eight mice and MHVsoR EGF treated seven mice one animal in this group died preliminarily due to an unrelated cause Brains were removed and preserved in 4 neutral buffered formaldehyde for histological analyses Animal experiments were approved by the local committee on animal experiments and carried out in compliance with Dutch laws Histopathology and immunohistochemistry The brains were fixed in 4 neu tral buffered formaldehyde overnight and subsequently trimmed and paraffin embedded Brain samples that included the area of inoculation were cut into 4 H9262m sections by using a standard microtome sectioned from cranial to caudal Hematoxylin eosin staining was performed on tissue sections to analyze mor phology and the presence of neoplastic cells by light microscopy Staining for viral proteins on seven of seven brains from the MHVsoR EGF treated group and on three of eight brains from the MHVsoR h His treated group was per formed as described by de Haan et al 6 Statistical analysis For mice with intracerebral tumors statistically significant differences in survival between treatment group and control groups were as sessed by the Wilcoxon test RESULTS Generation of EGFR directed adapter proteins and their ability to redirect MHV to the EGFR The EGFR is currently considered a very suitable target for virotherapy due to its high abundance on most tumors Thus we designed an adapter protein composed of the 53 amino acid EGF protein linked directly to the N terminal D1 domain of the MHV receptor mCEACAM1a soR to which we added a C terminal myc and His tag A schematic picture of the construct is depicted in Fig 1B along with the control construct lacking the EGF gene which was optimized for targeting to an artificial His receptor 43 Both adapter proteins were produced by using a vaccinia virus T7 expression system in Ost 7 cells Western blot analysis of the culture supernatants using antibodies raised against N CEACAM Fc 15 showed that the adapter proteins were properly synthesized and secreted data not shown To study the targeting capacities of the soR EGF adapter protein we selected three CHO cell lines wild type cells which are refractory to MHV infection and without detectable EGFR expression CHO His scFv cells constitutively express ing an artificial His receptor i e a membrane anchored sin gle chain antibody that recognizes a six histidine peptide 18 and CHO EGFR cells expressing the wild type EGFR 29 MHV EFLM an MHV strain A59 derivative expressing fire fly luciferase 8 was incubated with equal amounts of the adapter proteins as determined by Western bloting and sub sequently inoculated onto the wild type or mutant CHO cells Luciferase activity was measured to determine whether inoc ulation had resulted in successful infection of the target cells Fig 1C The data show that whereas both soR EGF and soR h His were able to redirect MHV EFLM to the CHO His scFv cells infection of CHO EGFR cells could only be achieved by preincubating the virus with soR EGF and not with the soR h His protein This result demonstrated that the infection of CHO EFGR cells was mediated specifically by the EGF targeting moiety present in the soR EGF adapter pro tein Similar inoculations of the parental CHO cell line re sulted in background levels of luciferase activity only both with soR h His and with soR EGF Generation and growth characteristics of recombinant MHVsoR h His and MHVsoR EGF viruses Our next aim was to incorporate the adapter genes into the viral genome in order to generate viruses that produce their own targeting devices thereby acquiring the ability to independently multiply in the appropriate target cells Thus recombinant viruses MHVsoR h His described elsewhere 43 and MHVsoR EGF both derivatives of MHV strain A59 in which the adapter genes replace the viral genes 2a HE were produced by using targeted RNA recombination technology Fig 2A These viruses rep licated in murine LR7 cells with similar kinetics and to approx imately similar titers as MHVd2aHE a virus lacking the 2a HE genes Fig 2B They were found to stably maintain their inserts for at least five passages data not shown MHVsoR EGF can specifically infect EGFR expressing cells To demonstrate that the adapter protein soR EGF was produced from the expression cassette in the recombinant MHVsoR EGF viruses CHO EGFR cells were inoculated with the recombinant MHV viruses incubated for 20 h and processed for an immunoperoxidase labeling using anti MHV serum Microscopic analysis of the cells showed staining of viral proteins in cultures inoculated with MHVsoR EGF but not in those inoculated with MHVsoR h His Fig 3A Large areas of cell cell fusion were observed in the MHVsoR EGF infected CHO EGFR cells a finding indicative of an intact fusion capacity of the virus when expressing a soR EGF adapter Fig 3A shown at H1100320 magnification Inoculation of wild type CHO cells did not result in the expression of viral proteins indicating that EGFR negative cells could not be infected with this virus The specificity of the targeted infection was confirmed by showing that the virus could be blocked in a dose dependent manner by an MAb directed against the EGFR Fig 3B The infection could not be fully blocked by this MAb which was likely due to the rather low con